circad | circRNAs associated with diseases

cTFRC
Gene	TFRC	Organism	Human
Genome Locus		Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30782157
Experimental Method
Sample Type	Tissue and cell lines	Comparison	three BC tissues and paired non-cancerous matched tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCTGTCCAGCAGCCATAGG Reverse TCATTCTGAACTGCCACACAGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Su, H, Tao, T, Yang, Z, Kang, X, Zhang, X, Kang, D, Wu, S, Li, C (2019). Circular RNA cTFRC acts as the sponge of MicroRNA-107 to promote bladder carcinoma progression. Mol. Cancer, 18, 1:27.